Sessions allow users to save snapshots of the Genome Browser and its current configuration, including displayed tracks, position, and custom track data. The Public Sessions tool allows users to easily share those sessions that they deem interesting with the rest of the world's researchers. You can add your own sessions to this list by checking the appropriate box on the Session Management page.
Description: te Author: aryanzandi123 Session Name: Polycomb and Chromatin-Binding Proteins Window Genome Assembly: hg38 Creation Date: 2024-12-11 Views: 9
Description: CTCF and SMC1 ChIP-seq data for Crewe et al submission to NAR Author: Morgan.Crewe Session Name: NAR_CTCF_SMC1_Data Genome Assembly: mm10 Creation Date: 2024-12-10 Views: 14
Description: A new study in Nature reveals how the absence of a small gene segment due to alternative splicing in CPEB4 leads to the deregulation of 200 genes associated with autism spectrum disorders: https://www.nature.com/articles/s41586-024-08289-w An earlier work by the same authors identified this mRNA as a factor in the autism-like phenotype: https://www.nature.com/articles/s41586-018-0423-5 The work took place at IRB Barcelona: https://www.irbbarcelona.org/en/news/scientific/key-breakthrough-autism-pivotal-role-cpeb4-condensates-revealed: “Our results suggest that even small decreases in the percentage of microexon inclusion can have significant effects. This would explain why some individuals without a gene mutation develop idiopathic autism.” UCSC Genome Browser Session Author: brianlee Session Name: CPEB4_GCAAGGACATATGGGCGAAGGAGA Genome Assembly: hg38 Creation Date: 2024-12-05 Views: 25
Description: Rearrangements of the 17q24.3 region associated with abnormal phenotypes. Author: 429035671 Session Name: Pei_et_al_2025_fig5 Genome Assembly: hg19 Creation Date: 2024-12-04 Views: 99